Время высыхания грунтовки: Сколько сохнет грунтовка на стенах: подробная информация по времени

Содержание

Сколько сохнет грунтовка на стенах: подробная информация по времени

Сколько сохнет грунтовка на стенах

Сколько сохнет грунтовка на стенах

Содержание статьи

От чего зависит время высыхания грунтовки 

Ответить на этот вопрос простым утверждением, что грунтовка сохнет столько-то минут или часов, невозможно. И вот почему: 

  • грунтовки бывают разными по своему составу: водными, акриловыми, алкидными и т.д.;
  • стены тоже могут быть из разных материалов: дерева, бетона, кирпича, гипсокартона. К тому же грунтовка при их отделке часто наносится на каждый черновой слой – штукатурку, стартовую и финишную шпаклевку. У всех этих материалов отличается способность к впитыванию; Выбор грунта зависит от материала стен

    Выбор грунта зависит от материала стен

  • грунтовка может наноситься в один слой, а может в два или в три. Грунтовочный слой разной толщины сохнет не одинаково; 
  • наконец, в помещении, где проводится отделка, может быть разная влажность воздуха и температура – параметры, напрямую влияющие на скорость высыхания любых «мокрых» материалов. Условия в помещении влияют на скорость высыхания состава

    Условия в помещении влияют на скорость высыхания состава

Обратите внимание! На упаковке с грунтовочным средством производители наряду с прочими рекомендациями по применению всегда указывают время его высыхания. Но оно является ориентировочным и, как правило, максимальным. При благоприятных микроклиматических условиях грунтовка может высохнуть гораздо быстрее. Это бывает важно, если сроки проведения работ ограничены. 

Задачка получается с несколькими неизвестными, и решить её без должного опыта не получится. Для этого нужно знать свойства материалов и понимать, для чего вообще применяется грунтовка, какая из них лучше справится с поставленной задачей. 

Виды грунтовок и их назначение 

Грунтовка обладает множеством функций. Перечислим основные. 

  1. Замоноличивание сыпучих и пористых оснований. Нанесенный на них состав связывает все частицы в единое целое, заполняет поры и образует прочную сплошную поверхность.  Укрепляющий грунт

    Укрепляющий грунт

  2. Улучшение адгезии или сцепления с основанием материалов, которыми предполагается отделывать стены.  
  3. Уменьшение способности отделываемой поверхности поглощать влагу, что приводит к экономии дорогостоящих материалов – красок, клеев, шпаклевок. Акриловая грунтовка для подготовки стен перед оклеиванием или покраской

    Акриловая грунтовка для подготовки стен перед оклеиванием или покраской

  4. Защита поверхности от размножения на ней плесени. А в случае с грунтовкой по металлу – от появления коррозии.

Разные средства обладают определенным набором этих функций в зависимости от назначения.  

Грунтовки для минеральных поверхностей 

Оштукатуренные, бетонные, газобетонные или кирпичные стены перед дальнейшей отделкой могут потребовать обработки следующими видами грунтовок: 

  • проникающими или грунтовками глубокого проникновения. Раствор глубоко впитывается в материал и полимеризуется, скрепляя частицы рыхлой или осыпающейся поверхности. Часто в них вводят фунгицидные добавки; Грунтовка водно-дисперсионная глубокого проникновения

    Грунтовка водно-дисперсионная глубокого проникновения

  • бетоноконтактом – особым видом грунтовки, содержащей в своем составе абразивные частицы (песок). Она наносится на гладкие поверхности типа бетонных или гипсокартонных панелей, окрашенных масляной краской стен, кафельной плитки, и делает их шероховатыми. К такой поверхности лучше пристает шпаклевка, плиточный клей и другие смеси; Грунтовка бетоноконтакт

    Грунтовка бетоноконтакт

  • укрепляющими, с большим содержанием клеящих веществ, упрочняющих поверхность; Грунтовка укрепляющая (концентрат)

    Грунтовка укрепляющая (концентрат)

  • универсальными, обладающими и адгезивными, и укрепляющими свойствами. Универсальные грунтовки

    Универсальные грунтовки

Эти составы изготавливаются на водной или синтетической основе и бывают эмульсионными, акриловыми, эпоксидными, полиуретановыми. 

Цены на грунтовку глубокого проникновения

Грунтовка глубокого проникновения

Грунтовки для дерева

Грунтовка для дерева

Грунтовка для дерева

Они подразделяются на два основных вида: защитные и отделочные. 

  1. Защитные водорастворимые грунтовки обладают антигрибковыми, инсектицидными, антисептическими свойствами и ограждают древесину от таких биологических вредителей, как насекомые, грибки, грызуны, водоросли и т.д.
  2. Отделочные алкидные составы вспучивают и разрыхляют структуру дерева, что значительно улучшает его сцепление с краской – она меньше впитывается и ровнее ложится на поверхность.

Для справки. Тонированный алкидный грунт может и полностью заменить собой лакокрасочный слой, если нанести его в несколько слоев.

Алкидный грунт нанесен на деревянную поверхность

Алкидный грунт нанесен на деревянную поверхность

Знакомая всем олифа – это тоже грунтовка для обработки деревянных поверхностей под покраску. Она прекрасно защищает его от гниения.

Олифа

Олифа

Часто вместо специальной грунтовки используют разведенный водой клей ПВА или разбавленную растворителем масляную краску либо эмаль. Они создают на поверхности пленку и уменьшают расход декоративного покрытия.

Грунт из клея ПВА позволяет укрепить поверхности перед отделкой

Грунт из клея ПВА позволяет укрепить поверхности перед отделкой

Цены на средства для защиты древесины

Пропитка для дерева

Сколько сохнут грунтовки 

Для начала расскажем, почему так важно, чтобы грунт, нанесенный на стены, высох, прежде чем продолжится их отделка. 

Если это проникающая грунтовка, то ей для реакции полимеризации нужен кислород. Слой шпаклевки или краски, нанесенный слишком поспешно, не даст этой реакции завершиться, и средство не будет качественно выполнять свою функцию. 

Водные эмульсии, нанесенные на штукатурку или шпаклевку, размягчают их верхний слой. И при попытке покрасить стену на валик будет налипать раствор, сводя на нет всю работу.

Грунтовка стен: процесс

Грунтовка стен: процесс

Клеить обои на ещё влажные стены тоже не рекомендуется – они будут дольше сохнуть и могут отвалиться. 

Поэтому лучше не нарушать технологию и соблюдать рекомендации производителя, дав грунтовке достаточно времени для высыхания. Оно, как уже говорилось выше, зависит от её вида и материала основания. Приведем данные по основным видам и составам. Время в таблице указано для температуры воздуха 15-25 градусов и влажности 50-60%. 

Вид грунтовки Время сушки, часов 
Проникающие грунтовки 1
Универсальные адгезивные грунтовки 1-3 
Акриловые и латексные грунтовки 2-4 
Укрепляющие водоотталкивающие грунтовки 1-2 
Алкидные грунтовки 8-12 
Бетоноконтакт  12-24 
Поливинилацетатные грунтовки 0,5-1 
Олифа  Не менее 24 
Битумный праймер 3-4 

Это рекомендуемые сроки для просушки одного слоя грунтовки. Если она наносилась в несколько слоев без окончательной просушки предыдущих, время может увеличиться в 2-3 раза. 

Совет. Если после первого грунтования на ладони остаются следы от шпаклевки или штукатурки, значит, одного слоя недостаточно и нужно наносить ещё один и снова проверять качество поверхности.

Но коррективы вносит и сама огрунтованная поверхность, её изначальная влажность и способность к впитыванию. Например, плотные, твердые и гладкие материалы сохнут дольше, тогда как штукатурка на цементной основе высыхает буквально на глазах.

Стена грунтованная под обои

Стена, огрунтованная под обои

При отделке наружных стен значение имеют погодные условия: после дождя стены будут сохнуть дольше, а на ветру быстрее. 

Но на глаз определять степень сухости не стоит. Для этого существуют специальные приборы – влагомеры или гигрометры. Конечно, приобретать их ради одноразового косметического ремонта в квартире вряд ли нужно. Но профессиональным отделочникам он очень пригодится. Если же такого прибора нет, лучше следовать рекомендациям производителя грунтовки и выдерживать указанное в инструкции время. 

Если в помещении холодно или сыро, стоит подумать, как исправить ситуацию – включить обогреватели, открыть окна для удаления лишней влажности воздуха. 

Как подготовить стены к поклейке обоев 

Решив поменять старые обои на новые, не стоит игнорировать правильную технологию этого процесса. Даже если при предыдущем ремонте стены были идеально подготовлены, за время эксплуатации и при снятии старого покрытия они могли растерять часть своих свойств.  

Грунтовка тоже входит в этот процесс, причем наносится она дважды. Опишем его подробно. 

Шаг 1. Демонтаж старых обоев. Для облегчения их снятия со стен нужно использовать специальные растворы. Ими равномерно смачивают поверхность, дают обоям пропитаться и целыми полотнам отклеивают от стен, максимально сохраняя целостность отделки.

Демонтаж старых обоев

Демонтаж старых обоев

Шаг 2. Грунтовка. Средство наливают в специальную емкость, смачивают в нем валик и прокатывают его по стенам, не оставляя пробелов.

Как разводить грунтовку для стен?

Как разводить грунтовку для стен?

Грунтовка в лотке

Грунтовка в лотке

Нанесение грунта на стену

Нанесение грунта на стену

Шаг 3. Штукатурка дефектов. После высыхания грунтовки штукатурным или стартовым шпаклевочным раствором заделывают все выбоины, трещины и неровности стен. Ему тоже дают подсохнуть.

Штукатурка дефектов

Штукатурка дефектов

Шаг 4. Сплошное выравнивание. Оно выполняется тонким слоем по всей поверхности финишной шпаклевкой.

Способы нанесения финишной шпаклёвки

Способы нанесения финишной шпаклёвки

Цены на популярные виды шпатлевки

Шпатлевки

Шаг 5. Грунтовка под обои. Зашпаклеванная поверхность не обладает достаточной прочностью – в этом можно убедиться, проведя рукой по высохшей стене. Укрепить её можно разведенным водой обойным клеем. Но не в той концентрации, которая требуется для наклейки обоев, а гораздо жиже.

Грунтовка под обои

Грунтовка под обои

Шаг 6. Просушка. Прежде чем приступать к финальной отделке, нужно выждать 3-4 часа. 

Видео – Подготовка стен перед поклейкой обоев 

Неопытные отделочники часто совершают и другую ошибку, когда грунтуют стены сильно заранее. Важно, чтобы на загрунтованную поверхность не осела пыль, иначе смысл грунтовки, как связующего средства, полностью теряется. Кроме того, стены могут быть испачканы маслом, жиром или другими веществами, на которые плохо ложится краска и строительные смеси. 

Поэтому грунтовать их нужно непосредственно перед следующим этапом отделки, оставляя время только на высыхание.

Сколько сохнет грунтовка? Время высыхания на стенах перед шпаклевкой и поклейкой обоев, сколько должна сохнуть акриловая грунтовка

В настоящее время сложно представить ремонт без использования современных материалов и средств. Они помогают строителям создавать более качественные и долговечные покрытия.

Одним из таких средств является грунтовка. Это средство помогает сцеплению материалов и выравнивает поверхности.

Особенности

Важно знать, сколько потребуется времени на то, чтобы высохла грунтовка. Это необходимая информация для рабочих и мастеров, чтобы знать, когда начинать новый этап ремонтных работ. Такой показатель крайне важен в процессе капитального ремонта и отделочных работ.

Это уникальное по своим свойствам средство, которое помогает улучшить адгезию. Главным достоинством грунтовки является ее связующая способность. Благодаря такой характеристике значительно сокращается расход краски, клеящего состава и прочих материалов. Качественный грунтовочный материал обладает хорошими антибактериальными и противогрибковыми свойствами. Благодаря таким характеристикам можно спокойно заниматься поклейкой обоев и не бояться в дальнейшем появления грибка и плесени.

Ряд людей считает использование данного средства перед покраской или оклейкой стен бессмысленным. Чаще всего это касается начинающих мастеров или людей, желающих самостоятельно выполнить ремонт в своем жилище. Только со временем они начинают понимать, как глубоко заблуждались. Ведь предварительная грунтовка стен помогает значительно сэкономить, сократив расход отделочных материалов.

После нанесения грунтовки на стену необходимо подождать некоторое время, прежде чем продолжить ремонтные работы. Время ожидания производители обычно указывают на упаковках с раствором. Но этот критерий может меняться из-за типа основания и прочих аспектов. При наличии сухой или пористой поверхности приступать к дальнейшей работе возможно через очень короткое время.

Перед покупкой данного средства стоит определиться, для каких поверхностей оно будет использоваться. Не стоит забывать и о прилагаемой инструкции к раствору. Чем выше проникающая способность у грунтовки, тем она качественнее.

Виды

В настоящее время на строительных рынках и в магазинах представлено несколько видов грунтовочных средств.

Рассмотрим наиболее популярные из них:

  • Грунтовка на основе акрила является универсальной. Ее можно использовать для обработки практически всех поверхностей. После нанесения этого средства любая поверхность становится более гладкой и меньше впитывает влагу.
  • Для работы по дереву стоит выбирать алкидный раствор. Он также отлично подойдет для обработки металлических деталей.
  • Глифталевая используется как основа под поклейку обоев и других материалов. Ее можно наносить перед шпаклевкой и штукатуркой.
  • Алюминиевый раствор пригоден только для работы по деревянной поверхности. Такая грунтовка способствует защите от влаги, а также препятствует появлению грибка и плесени.
  • Поливинилацетатные средства используют в качестве основы под покраску. Их стоит использовать для особых видов краски, бетона и деревянных оснований.
  • Силикатная грунтовка должна применяться на стенах из кирпича или под декоративной штукатуркой. Это средство глубокого проникает во все трещины и хорошо их заполняет.
  • Эпоксидная грунтовка отлично проявляет себя на бетонной поверхности.

Сохнет грунтовка по-разному. Это зависит от входящих в ее состав грунтовки веществ и температуры воздуха в помещении.

Когда нужно грунтовать?

Грунтовочную смесь по праву можно назвать самым универсальным средством при ремонте. Она помогает более прочно соединить между собой строительные материалы и препятствует образованию коррозии.

Если в процессе работ стены были поштукатурены, то грунтовать их можно только через месяц. Перед покраской стен нужно размешать смесь тщательным образом. Обычно ее наносят в один слой, но в некоторых случаях требуется наносить несколько. Второй слой наносится после того, как полностью высох первый.

Грунтовочные средства наносятся на штукатурку или краску. В такой ситуации грунтовка выполняет роль связующего звена между частичками краски или штукатурки, это помогает делать стену или потолок более ровными и позволяет сэкономить краску или клей за счет уменьшения впитывающих свойств поверхности.

При работе со шпаклевкой грунтовать стены тоже необходимо. Если она будет наноситься в несколько слоев, то перед каждым новым слоем необходимо покрывать поверхность грунтовочной смесью.

Вне зависимости от того, из чего сделана стена, в ней будут трещины и различные неровности. Грунтовочная смесь помогает это сгладить. За счет этого следующий слой отделочного материала ложится более ровно.

Грунтовка улучшает сцепление краски с любой поверхностью. Это защищает краску от появления трещин. Грунтовочная смесь способствует экономии шпаклевки. При засыхании она образует специальную пленку, которая препятствует появлению пятен и грибка.

На грунтовку значительно проще и ровнее наносится слой шпаклевки. В состав смеси входят различные элементы, которые препятствуют образованию грибка и плесени.

Грунтовка наносится на сухие поверхности, предварительно хорошо обезжиренные. Если не соблюдать эти правила, то в итоге можно получить неравномерно нанесенную краску, трещины или отслойку шпаклевки и обоев.

Прежде чем приступить к оклейке обоев, стены нужно хорошо подготовить.

Грунтовочная смесь разводится в большой емкости согласно прилагаемой инструкции. Если появились комочки, их нужно тщательно перемешать. В этом поможет дрель со специальной насадкой.

Затем полученный раствор нужно наносить на стену. Опытные мастера используют валик. Это помогает минимизировать свои временные затраты.

После того, как первый слой нанесен, нужно подождать определенное время. Количество его будет зависеть от вида грунтовки. Затем наносится второй слой, а после его полного высыхания можно приступать к финишным работам. Это поможет уменьшить количество впитываемого материала в гипсокартон.

Что влияет на время высыхания?

На процесс высыхания оказывает влияние несколько критериев:

  • Климатические условия в комнате. Если в помещении слишком жарко или холодно, то грунтовка будет сохнуть очень долго.
  • Чем тоньше будет слой грунтовки, тем быстрее она будет сохнуть.
  • В состав грунтовки входят специальные составы, которые имеют свойство быстро улетучиваться с поверхности.
  • Время высыхания зависит и от структуры поверхности, на которую она будут нанесена. Чем глубже смесь проникнет внутрь, тем дольше она будет сохнуть.

Перед тем, как начать поклейку обоев, нужно дождаться, чтобы грунтовка окончательно высохла.

Как правило, производители указывают информацию об основном составе и примерном времени, необходимом для высыхания раствора. Также время зависит от вида грунтовочного материала. Средства на основе акрила высыхают в течении 5 часов.

Алкидные смеси сохнут очень долго. Ждать этого потребуется от 20 часов и более. Важным критерием станет температура воздуха в помещении. Дольше всего сохнет глифталевая грунтовка. На высыхание этого средства может уйти более 24 часов. А быстрее всего в этом плане средства на водной основе. После их нанесения к поклейке обоев можно приступать через 20 минут.

Когда средство нанесено на стену, важно соблюдать несколько основных правил:

  • поддерживать в помещении одинаковую температуру;
  • избегать сквозняков, так как они могут послужить поводом для неравномерного покрытия;
  • нельзя использовать искусственную сушку, чтобы ускорить процесс высыхания грунтовки.

После готовности поверхности необходимо моментально приступать к поклейке обоев. При работе со шпаклевкой применяется немного другая технология работ. Начинать шпаклевку необходимо сразу после нанесения слоя грунтовки.

У раствора глубокого проникновения существует несколько особенностей. Если стена пористая, то, возможно, понадобится два слоя грунтовки. Идеальная температура работы с таким раствором не должна превышать 25 градусов Цельсия.

Использование краски на полу, стенах и потолке является наиболее быстрым способом изменения интерьера в квартире или доме. Краска может использоваться и в ванной комнате, где постоянно высокая влажность.

Если нельзя удалить старый слой краски, то поверх него нужно нанести тонкий слой грунтовки. Для такого случая существует специальная смесь. После ее нанесения красить поверхности можно через 2 часа.

На бетонной стене стоит использовать определенный вид грунтовки. Как правило, в этом случае лучше всего себя ведет смесь на акриловой основе. Для фасада стоит выбирать пленкообразующие смеси.

Полезные рекомендации

Опытные мастера и строители рекомендуют отнестись к выбору грунтовочного состава очень внимательно. Выбор конкретного средства и конкретного производителя будет зависеть от характеристик поверхностей, на которые грунтовка в последующем будет наноситься.

Гладкая поверхность бетонной стены нуждается в смеси с абразивными частицами. Они сделают поверхность более шероховатой, что будет способствовать лучшему нанесению последующих отделочных материалов.

Металлические поверхности обязательно нужно покрыть специальной смесью с антикоррозийными свойствами. Это защитит металл от появления ржавчины.

Для деревянных поверхностей существуют специальные грунтовки на водной основе. Они сохранят древесину как можно дольше и защитят ее от гниения и повышенного впитывания влаги. В составе грунтовочной смеси должны быть вещества, которые препятствуют появлению короедов и прочих вредителей. Если новую древесину обработать шелаком, то она не будет выделять смолы. Это поможет в дальнейшем избежать различия в оттенках.

Для комнат с высокой степенью влажности стоит использовать грунтовку с антибактериальным эффектом. Данная информация обычно написана производителями на упаковке материала.

Для работы с гипсокартоном стоит использовать грунтовку глубокого проникновения. Это поможет уменьшить количество впитываемого материала в покрытие стен.

Наносить шпаклевку перед грунтовочной смесью нужно для лучшего сцепления всех материалов. А вот нанесенная поверх шпаклевки грунтовка будет способствовать долгому сроку службы. Стоит обращать внимание и покупать составы от одной компании-производителя. Это позволит всем веществам и компонентам в большей степени раскрыть все свои свойства и выполнить свои функции наиболее качественно.

После нанесения смеси, стоит избегать перепады температуры в первые 3 суток, после использования. В противном случае все покрытие может дать трещину.

Некоторые специалисты наносят грунтовочную смесь при помощи пульверизатора. Это поможет начинающим мастерам добиться более ровного нанесения на поверхность.

Опытные строители рекомендуют в целях экономии бюджета для некоторых помещений грунтовочную смесь делать самостоятельно. Важно рассчитывать необходимое количество строительных материалов.

Старый слой штукатурки иногда можно и не удалять. Но перед поклейкой обоев по нему нужно пройтись смесью глубокого проникновения.

Некоторые поверхности впитывают много влаги и имеют пористую структуру. Чтобы определиться с необходимым количеством средства для них, стоит произвести небольшую проверку. Кусок поролона смачивается в воде и прикладывается к нужной поверхности. В местах, где жидкость впиталась быстрее, понадобится больше грунтовочной смеси.

Грунтовку нужно наносить лишь на ту на поверхность, с которой тщательно удалены плесень и грибок.

Стены перед нанесением финишного покрытия обязательно нужно грунтовать. В этом едины мнения всех опытных мастеров. Благодаря такой технологии получится прочное покрытие, которое прослужит долгие годы.

Из видео ниже вы узнаете, чем лучше грунтовать стены под обои и под краску.

Сколько сохнет грунтовка - что влияет на время

сколько грунтовка

Во время проведения ремонтных работ необходимо точно рассчитывать, когда именно будет готова та или иная плоскость после обработки грунтовкой. Такой материал используется повсеместно практически в любом ремонте. Ее наносят под обои, на потолок и перед покраской. Чтобы сделать качественное исполнение, необходимо знать сколько сохнет грунтовка. Это поможет сделать качественное покрытие, ведь наносить пласты друг на друга пока они нисколько не высохли не рекомендуется.

Время высыхания

Виды составов и сколько они сохнут

Существует множество разных видов грунтовки. Также у каждого производителя свой состав. Эти факторы также влияют на время высыхания грунтовки. Разные типы продуктов могут высыхать за разное время, и порой интервал составляет несколько часов и более.

Например, различают такие виды продукта:

  • Кварцевая или контактная. Смесь включает в свой состав кварцевый песок. Этот компонент позволяет значительно повысить сцепляющие характеристики поверхности. Также кварцевая хорошо укрепляет основание. Такой продукт является проникающим, это значит, что он глубоко проникает в поверхность на 3 мм. Такое эффект помогает материалу держаться на плоскости и не отваливаться со временем. Как правило, длительность полной сушки одного ряда может растянутся на 1-5 часов. Это зависит от его толщины.
  • Проникающая акриловая. Этот тип материала используются для того, чтобы значительно увеличить прочность стен и других плоскостей. Изготавливается данная смесь из минерального материала. Этот тип проникает в поверхность на 3 мм. Акриловая полностью высыхает за 12-24 часа. В основном ее рекомендуется оставлять на сутки.
  • Алкидная. Такой тип материала требуется использовать для обработки плоскостей из дерева и металла. Продукт защищает обработанные стены от образования плесени, лишней сырости и ржавчина. На полное высыхание требуется от 12 часов. Рекомендуется дождаться полного высыхания перед покраской, в противном случае расход краски может увеличиться или нанесение произойдет неровными пластами.
  • Шеллаковая. В составе содержатся компоненты с добавлением спирта. Благодаря этому растворители в материале быстро испаряются и ряды просыхают за короткий промежуток времени. В основном требуется около 8 часов для полного высыхания пласта.
  • Минеральная. Этот тип строительного материала отличаются от других быстрой впитываемостью и схватываемостью. Довольно часто используется для обработки стен из бетона и кирпича. Высыхает за 5-8 часов.
  • Быстросохнущая грунтовка. Этот продукт специально разработан для быстрого ремонта. Она быстро высыхает. Достаточно и 10 минут после нанесения слоя чтобы приступит к дальнейшей отделке поверхности. При нанесении несколько слоев может потребоваться около 6 часов, в это время входит высыхание каждого ряда и время его нанесения. Красить после грунтовки стены и другие поверхности требуется только после полного высыхания.
  •  Масляная. Масляный грунт высыхает немного дольше остальных видов. Таким образом для высыхания одного слоя требуется не менее суток.
  • На основе воды. Используется для обработки поверхностей, выполненных из бетона. После нанесения слоя требуется выждать около 2 часов до следующих работ. Может использоваться непосредственно перед окрашиванием.

Важно! При использовании материала стоит понимать, что применение сырья, который рассчитан на другой тип поверхности, может время высыхание увеличить. Лучше подбирать материал строго под тип поверхностей, ориентируясь на свойства и разновидности.

Виды составов

Факторы, влияющие на высыхание

Также на высыхание грунтовки могут влиять и другие факторы. Все зависит от среды помещения в котором происходят ремонтные работы. Так, например, на сроки высыхания одного слоя грунта могут влиять такие аспекты как:

  1. Тип материала. Каждый вид грунтовки требует определенное количество времени для полного высыхания. В зависимости от вида продукты срок может составлять от 10 минут до суток.
  2. Основа. У каждого продукта используется определённый тип основы всего продукты. Так, например, контактная основа застывает за 3 часа, а вот акриловой понадобится не менее одних суток.
  3. Влажность и температура. Рекомендуемыми параметрами для высыхания считаются влажность до 65 % и температура воздуха около 20-25 градусов. Стоит понимать, что чем ниже температура в помещении, тем дольше будет высыхать грунтовка.
  4. Материал поверхности. В том случае если поверхность выполнена из материала с пористой структурой, то грунт быстро впитается и высохнет. Также на это влияет тип основания.
  5. Плотность нанесения. Стоит понимать, что плотные слои высыхают в разы больше чем тонкие. Также следует обращать внимание за равномерностью нанесения грунтовки. От этого будет зависеть сколько будет сохнуть вся площадь перед покраской.

Важно! Чтобы точно узнать сколько должна сохнуть грунтовка рекомендуется ознакомиться с инструкцией от производителя, где должно все указываться. В ней должны четко обозначаться границы времени, а также рекомендации по эксплуатации.

Факторы, влияющие

Методы ускорения

В наличии необходимости уменьшения срока высыхания можно использовать такие хитрости как:

  • Использовать специальный грунт, который сохнет намного быстрее других видов. В нем, как правило, присутствуют добавки, которые ускоряют высыхание грунта.
  • Использовать тепловую пушку для того чтобы просушить поверхность.

У этих методов есть свои преимущества. Таким образом к преимуществам использования специальной грунтовки относятся:

  1.  Сколько точно сохнет поверхность трудно сказать. В основном количество времени для полного испарения влаги из слоя составит около 5 часов. Также есть виды грунтовки, которые готовы к дальнейшему нанесению других отделочных материалов спустя 10 минут.
  2. Такой тип грунта можно без опасений использовать в помещениях с высокими перепадами температур.

Совет! Лучше использовать универсальную грунтовку. Она идеально подходит для покраски и поклейки обоев.

Но у данного метода есть и свои недостатки. К ним в основном относятся наличие в смеси токсичных продуктов. А также что их практически не

используют для внутренней отделки. Помимо этого, из-за быстрого просыхания сцепление с другими слоями может быть слабым.

А вот при использовании тепловой пушки необходимо следовать некоторым правилам:

  • Некоторые участки нельзя просушивать при высоких температурах. Это может привести к их осыпанию.
  • Не рекомендуется использовать максимальный напор подачи струи воздуха. Мокрый пласт может вдавится под воздействие такого давления.
  • Температура воздуха от пушки не должна превышать 30 градусов. Также пушку устанавливают на расстоянии от стены, вплотную прижимать строго запрещается.
  • Из-за слишком быстрого испарения стоит проветривать помещение. Нагрев таких смесей выделяет вредные вещества, а постоянное проветривание поможет снизить их концентрацию в воздухе.

Важно! Перед использованием тепловой пушки стоит уточнить разрешено ли это в отношение использованного типа грунтовки. Некоторые смеси имеют вещества, которые не рекомендуется испарять в быстром темпе, как правило, высыхает такая грунтовка очень долго.

Пышку требуется использовать строго по правилам. Даже упущения одного из пункта может полностью испортить покрытие. Довольно часто при высушивании грунтовки под поклейку обоев ее слишком обезвоживают. И расход клея от этого увеличивается, так как поверхность слишком быстро его впитывает.

Методы

Рекомендации по нанесению грунтовки для быстрого высыхания

Чтобы сохранить все полезные свойства и характеристики грунтовочной смеси, необходимо строго следовать инструкции по ее применению. Каждый производитель указывает как именно использовать тот или иной тип грунтовки. Таким образом рекомендуется следовать правилам, которые помогут сократить время сушки материала:

  1. Слои грунтовки должны быть максимально тонкими. Для нанесения стоит использовать соответствующие инструменты как кисточки и валики. Также можно использовать распылители, так как они позволяют быстро нанести равномерным слоем материал на большую поверхность. Для этого можно приспособить и краскопульт.
  2. Строгое следование инструкции приведет к отличному результату. Необходимо разводить грунтовку по указанным правилам на упаковке. А также узнать, как и сколько нужно подготавливать поверхность перед нанесением.
  3. Грунтовать необходимо сверху вниз. Это позволит устранить подтеки и образование скоплений продукта на некоторых участках.
  4. Рекомендуется наносить несколько рядов. Минимальное количество нанесений пластов равняется двум. Также этот показатель можно увеличивать в связи с особенностями поверхности. Например, пористые плоскости грунтуют более 2 раз.
  5. Прежде, чем наносить еще один ряд, требуется дождаться просыхания предыдущего.

Важно! Использовать грунтовку требуется сразу же после разведения. Если она простоит несколько дней, то потеряет свои свойства и характеристики. Также, это повлияет на то сколько будет высыхать продукт.

Высыхание грунтовки на разных поверхностях

Грунтование может производится на разные поверхности. Например, зачастую при поклейке обоев стены грунтуют по штукатурке или шпаклевке. В зависимости от типа используемого материала перед грунтованием будет зависеть сколько в итоге потребуется времени для полного испарения влаги из грунтовки перед покраской.

Грунтовка на штукатурке сколько сохнет

На штукатурке грунтовка полностью высыхает за 3 часа. За такой срок грунтовка успевает высохнуть при соблюдении температурного режима от 20 градусов. Специалисты рекомендуют наносить пласты пропитывающего состава друг за другом. Для хорошего результата требуется минимум два слоя.

Разрешается наносить стартовый или финишный ряд шпаклевки, не дожидаясь полного испарения влаги из отделочного материала. А вот на шпаклевку следует нанести продукт для избегания осыпания мелких частиц. Это позволит подготовить поверхность к дальнейшим работам.

Если стены обрабатывались специальной штукатуркой на основе цемента и извести, то сушка грунтовочной смеси может составит около 6 часов, именно через такое количество времени можно красить стены после грунтовки. Чтобы удостоверится в том, что плоскость просохла, требуется провести рукой по стене. Если она сухая, то можно продолжить дальнейшие работы. Если чувствуется влажность требуется выждать еще несколько часов.

Сколько сохнет грунтовка по шпаклевке

Опытные мастера обязаны знать сколько требуется продукту для полного просыхания. Также перед шпаклевкой необходимо обрабатывать плоскость вспомогательной строительной смесью.

Сколько будет сохнуть продукт зависит в первую очередь от площади обрабатываемой поверхности. В этом случае нет четких границ для времени высыхания грунтовки. Но рекомендуется выждать около 5 часов перед другими работами.

Важно! Если планируется красить поверхность после грунтовки, то следует выждать, когда пройдет не менее 8-12 часов. Это заметно улучшит качество отделки, и краска ляжет ровнее.

Заключение

Многие влияет на то сколько времени будет сохнуть грунтовка. Следует полностью изучить все рекомендации от производителя, только так можно улучшить качество грунтованных поверхностей. От этого зависит и то как лягут другие ряды. Таким образом нельзя точно сказать сколько сохнет продукт, требуется ориентироваться на цифры от производителя.

время высыхания в зависимости от типа состава

Грунтование поверхностей – основной этап подготовительных работ перед финишной отделкой. Грунт образует на разных материалах тонкий слой, повышающий адгезивные (сцепляющие) свойства основания. Чтобы правильно выполнить отделку стен, пола, потолка перед нанесением финишного покрытия используют грунтовку. Составы представлены на строительном рынке в широком ассортименте, обладают разными свойствами и характеристиками. Важно знать, сколько сохнет грунтовка, ведь время высыхания составов зависит от множества факторов.

Грунтовочные работы

Виды составов и время их высыхания

Для обработки разнородных поверхностей перед нанесением отделочного покрытия проводят грунтование. Пропитки предназначены для работы с базовыми основаниями из различных материалов. В зависимости от этого выбирают грунтовку с оптимальными характеристиками и свойствами:

  • Акриловая грунтовка глубокого проникновения, применяемая для повышения прочности обрабатываемой поверхности. Состав глубоко проникает в структуру стен из минеральных материалов. Время высыхания слоя грунтовки составляет от 12 до 24 часов, после чего наступает полная полимеризация.
  • Грунтовка контактного типа на основе кварцевой пыли. Содержание кварца улучшает защитные свойства обрабатываемой поверхности. По способу пропитки относится к грунтовкам глубокого проникновения. Время высыхания грунтовки – от 1-6 часов, что зависит от количества нанесенных слоев.
  • Алкидная и масляная смесь. Используется для работы с деревянными и металлическими основаниями. Обладает выраженными влагозащитными свойствами. При помощи алкидных грунтовок удается подчеркнуть древесную фактуру или защитить металл от коррозийных процессов. Грунтовка по металлу сохнет 12 часов.
  • Бетоноконтактная грунтовка. Стены из песка и цемента обладают низкими адгезивными свойствами. Для улучшения сцепляемости с финишными покрытием используют грунтовку бетоноконтакт. Поскольку обрабатываемое основание непористое, гладкое, чтобы грунтовка полностью высохла, требуется не меньше 6 часов.
  • Глифталевый специальный раствор. Используется для обработки сухих помещений. Можно выполнять грунтование металлической поверхности в качестве начального слоя. Раствор наносят в хорошо проветриваемых помещениях. При комнатной температуре грунтовка сохнет 24 часа.

Грунтовка для стен

При выборе состава для грунтования учитывают, из какого материала выполнено основание, а также пористость основания и его адгезивные свойства. Для получения равномерного слоя и сохранения качественных характеристик состав используют сразу после приготовления.

На видео: время высыхания грунтовки.

Факторы, влияющие на высыхание

Подготовительные и отделочные работы осуществляют в разных помещениях, используя смеси, эмульсии, растворы на стенах, на потолке и полу. Температурные и влажностные показатели влияют на время высыхания грунтования. При различных условиях процесс полимеризации грунтовки может отличаться по временным параметрам. Факторы влияющие на то, как долго высыхает состав:

  • Толщина слоя. Грунтовочную смесь преимущественно наносят на стены, пол или потолок одним тонким равномерным слоем. Но если состояние базовой поверхности не идеальное, грунт необходимо нанести несколько раз. Процесс полимеризации длится дольше.
  • Тип и состав. Каждый производитель указывает время полного высыхания грунта на упаковке. Есть быстросохнущие растворы на водной основе – готовы под отделку через 2 часа, масляным составам требуется не менее суток.
  • Вид базового основания. Грунтовкой возможно обрабатывать стены (потолок) из дерева, бетона, оштукатуренные поверхности, конструкции с металлической составляющей, перегородки из гипсокартона, пеноблоков. Значение имеет пористость материала.
  • Влажность и температура. В сухом помещении грунтовка для стен любого типа готова к дальнейшей обработке не позднее 24 часов при оптимальной температуре в 23-25°C. В комнатах повышенной влажности или в помещениях с низкой температурой время высыхания состава увеличивается вдвое.

Чтобы рассчитать, через сколько времени раствор полностью впитается в поверхность, принимают во внимание тип материала и грунта, влажность и значение, указанное производителем продукции. Температура должна быть стабильной, искусственно сушить поверхности не рекомендуется.

грунтовка на стене

Подготовка к оклеиванию обоями

Обои – наиболее популярный и актуальный вариант финишной отделки. Перед наклеиванием полотен любого вида (текстильные, виниловые, шелкография, бумажные, бамбуковые) поверхность стен и потолков обязательно обрабатывают. Грунтовка стен перед поклейкой обоев обеспечивает антисептические свойства, способствует хорошей сцепляемости между обойным клеем, полотнами и поверхностью стен (или потолка). Наклеенные обои не отстают, не покрываются плесенью и грибком, отлично держатся несколько лет.

наклеивание обоев

Сколько сохнет грунтовка перед поклейкой обоев по типу состава:

  • Акриловая грунтовка под обои (кирпич, ДСП, бетон) при оптимальных условиях готова к поклейке обоями через 5 часов.
  • Алкидный грунт (по дереву) при температуре 25 градусов должен просохнуть за 10-15 часов.
  • Глифталевый состав (все виды внутренних поверхностей) – можно клеить обои через сутки после грунтовки стен.
  • Перхлорвиниловый раствор (бетон, кирпич) на водной основе сохнет за 20 минут, после чего можно наклеить обои.

После обработки пропиткой не нужно останавливаться – можно готовиться к следующему этапу, нарезать обои на полосы нужной длины, замочить обойный клей. Перед поклейкой обоев грунтовка должна сохнуть естественным путем, без температурных перепадов и использования строительного инструмента – тепловой пушки или фена. Сохнуть грунтовка перед поклейкой обоев будет несколько часов.

Подготовка обоев перед поклейкой

Работы перед покраской

Окрашивание – один из наиболее быстрых вариантов декора помещений. Краска обладает водоотталкивающими свойствами, поэтому может использоваться во влажных комнатах. Грунтовка перед покраской способствует прочному закреплению водоэмульсионного раствора или лакокрасочного материала. Вот сколько сохнет грунтовка на потолке или на стенах перед окрашиванием:

  • Быстросохнущие алкидные и эмалевые пропитки обладают определенной токсичностью. Красить обработанную поверхность можно через 1-4 часа – решающую роль играет количество слоев.
  • Материал с нормальной скоростью полимеризации (акриловый грунт) сохнет 4-6 часов. Используется под покраску чаще всего, поскольку обеспечивает идеально ровное покрытие стен, потолков.
  • Составы медленного высыхания. К ним относятся масляные грунты и смеси глубокого проникновения. Срок высыхания грунтуемой поверхности под покраску – не меньше суток.
  • Состав под эмульсионную краску легко и быстро впитывается, не требует разбавления, не имеет резкого запаха. Среднее время высыхания поверхности – 8-12 часов.
  • Пропитка на окрашенную основу. Рекомендуется удалять слой старой краски. Если это невозможно, но покрытие нанесено тонким слоем, можно использовать специальную грунтовку по старой краске. Сколько сохнуть грунтовке такого типа? Через два часа можно выполнять финишную отделку.

Грунтовка для стен под покраску

Перед окрашиванием используют пропитки, которые принято классифицировать на универсальные, сцепляющие, пигментированные и антисептические составы. Антисептики подходят для влажных помещений с постоянными перепадами температуры. Пигментированные композиции используют дополнительно в декоративных целях. Адгезионные пропитки с колером создают шероховатый слой для лучшей сцепляемости ЛКМ и обрабатываемых поверхностей.

Часто для работы применяют универсальную пропитку – акриловый грунт. Сколько сохнет акриловая грунтовка? В пределах 6-8 часов, что несколько быстрее относительно срока полимеризации контактных составов.

Акриловая грунтовка под покраску

Грунтование перед шпаклевкой или по штукатурке

Сколько времени сохнет грунтовка, и в какой последовательности выполняют отделочные работы? Правильный порядок: оштукатуривание базового основания, нанесение грунта, шпаклевка для выравнивания поверхности, грунтование. Заключительный этап — финишная отделка. Порядок действий не изменяется, но иногда клеить или красить можно сразу по штукатурке – в любом случае грунтовать поверхность необходимо.

процесс грунтования

С помощью этих приспособлений ремонт пройдёт успешно

Чтобы ремонтные работы не затянулись на неопределенный срок, важно знать, сколько сохнет грунтовка перед шпаклевкой или нанесением штукатурки:

  • При обильном нанесении грунта на оштукатуренную поверхность при температуре до 20 градусов слой сохнет 2-3 часа благодаря пористости и хорошей впитываемости основания. Рекомендуется наносить пропитывающий состав в два слоя, один за другим.
    Нанесение стартовой или финишной шпаклевки не требует полного высыхания слоя грунтовки. Процесс занимает в среднем 12 часов. Сразу после работы шпаклевку можно покрыть грунтом, чтобы не осыпались мелкие частицы состава.
  • При обработке цементно-известковой штукатурки время высыхания многих грунтовочных смесей составляет 6 часов. Для проверки по стене проводят рукой, чтобы оценить влажность поверхности. Чем ниже температура, тем дольше сохнет состав.
  • Быстрее всего высыхает грунт на шпаклевке – пару часов. Пока происходит грунтование, подготовленный участок стены успевает высохнуть. Чтобы видеть обработанные поверхности, в эмульсии добавляют колер.
  • Подготовка стен к финишной отделке включает использования грунтов из разных компонентов. Применение грунтовки (праймера) в процессе штукатурно-шпаклевочных работ не всегда требует полного высыхания слоя – достаточно выждать несколько часов.

Грунтовка под шпаклевку

Самый важный вопрос при проведении ремонта – сколько должна сохнуть грунтовка перед поклейкой обоев? Ответ прост, но неоднозначен: на упаковке указано время, рекомендуемое производителем. Сопоставив его с температурой, влажностью в комнате и типом материала, можно рассчитать оптимальное время высыхания грунта.

Приклеивайте небольшой квадратик из пленки на поверхность, чтобы узнать, высох ли материал. Утром отклейте его и проверьте наличие влаги. Если пленка чистая, то можно продолжать строительство.

пленка на стену

В заключение: для обработки стен и потолка можно использовать один и тот же состав при обработке поверхностей из однородного материала. Тогда время высыхания будет одинаковым. Если поверхность стен и потолка разнородная, процесс полимеризации смеси займет разное время.

Таблица: время высыхания различных видов грунтовки.

Вид и тип грунтовки Поверхность Время высыхания
Универсальная акриловая Кирпич

Плотный бетон

Штукатурка

Шпаклевка

Гипсокартон

6-8 ч

1-3 ч

2-5 ч

4-12 ч

12 ч

Бетоноконтактная Бетон

Цементно-известковое основание

24 ч

24 ч

Масляная Древесина 24 ч
Алкидная Древесина

Металл

10-12 ч

10-15 ч

Минеральная Камень и бетон 4-6 ч
Глифталевая Металл 24 ч
Перхлорвиниловая Наружные работы 1 ч
Фенольная Наружные работы 10-15 ч
Поливинилацетатная Для связки 15-30 мин
Спиртосодержащая Древесина 12-24 ч
Быстросохнущая Все основания 1-4 ч
Средней полимеризации Все основания 4-6 ч
Глубокой пропитки Все поверхности 24 ч
Под водоэмульсионную краску 8-12 ч
По старой краске – специальный раствор 2 ч


Как правильно грунтовать стены (2 видео)


Бренды и грунтовочные работы (27 фото)

Сколько сохнет грунтовка: глубокого проникновения, акриловая, алкидная?

Сколько сохнет грунтовка: глубокого проникновения, акриловая, алкидная?

Сколько сохнет грунтовка: глубокого проникновения, акриловая, алкидная?

Разделы статьи:

Грунтование стен и других поверхностей, самый что ни на есть, обычный процесс при выполнении ремонта и отделочных работ. Нужно ли грунтовать стены перед шпаклевкой или поклейкой обоев? Ответ на этот вопрос — неоднозначен.

Однако можно с уверенностью сказать о том, что грунтовка с легкостью позволяет увеличить адгезионные свойства поверхностей и сократить расход отделочных материалов. В общем, этап грунтования очень важен при выполнении многих строительных процессов.

Вследствие этого, у многих людей, которые решили своими силами осуществить ремонт, возникает закономерный вопрос — сколько сохнет грунтовка? (прим. remstroisovet.ru) Вопрос на самом деле очень важный, ведь если нанести краску или другой отделочный материал на влажную поверхность, то ничего хорошего не будет.

При этом целесообразно заметить, что время высыхания грунтовки зависит от ряда таких факторов, как: состав грунтовки, температура и влажность в комнате, тип отделываемой поверхности, и многих других. Рассмотрим подробнее вопрос о том, сколько будет сохнуть грунтовка глубокого проникновения, на акриловой и латексной основе, а также другие виды грунтовок.

От чего зависит время высыхания грунтовки?

Прежде чем ответить на вопрос о том, сколько сохнет грунтовка, следует выделить факторы, влияющие на данный процесс. Так, время высыхания грунтовки напрямую зависит от того, на какую именно поверхность она была нанесена.

Если поверхность сухая, например, из силикатного кирпича и сильно пористая, то время высыхания грунтовки заметно уменьшится. Дольше всего высыхает грунтовка на металлическом и деревянном основании, которое практически лишено пор и плохо впитывает влагу.

От чего зависит время высыхания грунтовки?

Второй фактор, прямо пропорционально влияющий на время высыхания грунтовки, это температура воздуха и влажность. Чем выше в комнате будет температура, тем быстрее будет высыхать грунтовка. При этом степень влажности в помещении, также будет играть свою роль.

Сколько сохнет грунтовка?

Рассмотрим, сколько сохнет грунтовка глубокого проникновения, при температуре 15-25˚C в комнате и умеренной влажности. В данном случае, при нанесении грунтовки глубокого проникновения на штукатурную поверхность, время высыхания грунтовочного средства, составит приблизительно 3-5 часов.

Сколько сохнет грунтовкаАкриловые грунтовки сохнуть немного дольше, не менее 6-8 часов. При этом, как было сказано выше, на время высыхания грунтовки, во многом зависит тип поверхности, на которую она будет наноситься, а также, какие именно были выбраны материалы для отделки.

Так, например, если стена будет оклеена обоями, то приступать к началу работ можно уже через 1-2 часа после нанесения на её поверхность грунтовочного состава. Здесь главное чтобы грунтовка хорошо проникла в поры поверхности, и минимизировала тем самым слой пыли на них.

Сколько сохнет грунтовка: глубокого проникновения, акриловая, алкидная?Ниже в таблице наглядно продемонстрировано время высыхания самых распространенных видов грунтовок:

Виды грунтовок Время высыхания при t 15-25˚C
Грунтовка глубокого проникновения 2-3 часа
Водоотталкивающая грунтовка 1-3 часа
Акриловая грунтовка 3-5 часов
Алкидная грунтовка не менее 10 часов
Латексная грунтовка 1 час
Грунт универсального применения 1-3 часа
Грунтовка Ceresit 17 5-6 часов
Битумная грунтовка 1-3 часа
Глифталевая грунтовка 3-4 часа
Поливинилацетатные грунтовки 1-2 часа

Сколько сохнет грунтовка на стенах, полу и потолке; правила нанесения

Перед финишной отделкой для улучшения адгезии, продления времени службы покрытий и защиты от плесени стены и другие поверхности обрабатываются соответствующими составами, обладающими укрепляющими и связующими свойствами. Нанесение 2-3 слоев позволяет снизить расход клеевых растворов и лакокрасочных материалов.

Оглавление:

  1. Что влияет на скорость впитывания?
  2. Разновидности грунтовок
  3. Время сушки различных смесей
  4. Советы и рекомендации

Факторы, влияющие на срок высыхания

При обработке пористых либо сухих плоскостей грунтовка быстро проникает внутрь основания, поэтому процедуру необходимо повторять несколько раз до полного насыщения. Работу нужно выполнять как можно скорее, стараясь нанести следующий слой до образования защитной пленки, после застывания которой дальнейшее грунтование стен будет проблематичным.

Что влияет на время сушки:

1. Скорость проникновения средства в поры во много зависит от микроклимата в помещении. Чем прохладнее в комнате, тем больше времени потребуется для готовности поверхности к последующей отделке. Оптимальная температура – от 15 до 25°C.

2. Уровень влажности. Во время выполнения работ в комнате не должно быть сыро, рекомендуется заранее проветрить.


3. Материал стен, полов или потолков. Впитывание обильного слоя в цементно-песчаное основание происходит за 2-3 часа при нормальных температурных условиях. Если в помещении прохладно, то время сушки может продлиться до суток. На известковых поверхностях грунтовка сохнет на протяжении 4-6 часов. Для высыхания на плоскостях со шпатлевкой потребуется примерно такой же срок.

4. Способ обработки. При нанесении состава валиком или кистью слой впитается через 2-3 часа, а применение пульверизатора позволит несколько сократить время сушки.

5. Каждая поверхность имеет свой коэффициент влагопроницаемости, от величины которого зависит впитывание и то, сколько сохнет раствор. Значение этого параметра для каждой марки бетона различно.

Виды грунтовок по срокам высыхания

Классификация по времени полимеризации:

  • быстросохнущие;
  • нормально высыхающие;
  • сохнущие медленно.

К первым в большей степени относятся алкидные виды, нанесение краски на которые допускается спустя небольшой промежуток времени. Существенным недостатком является высокая токсичность, потому при выполнении работ необходимо использовать перчатки, защитные очки и респиратор.

Обычно нормально сохнущие составы образуют готовое покрытие через 4-6 часов после обработки стены или других поверхностей. Для полимеризации медленно впитывающихся веществ, к которым относятся практически все разновидности на масляной основе, требуется время от суток до двух недель.

Сроки застывания различных смесей

Время сушки грунтовки зависит от ее типа. Неправильный подбор может привести к потере свойств, перерасходу и дополнительным затратам. Некоторые виды не подходят для выполнения работ внутри помещений или пригодны для обработки не всех типов поверхностей.

Разновидности:

  • акриловые;
  • алкидные;
  • перхлорвиниловые;
  • поливинилацетатные;
  • фенольные.

1. Акриловые.

В них включено несколько компонентов:

  • вяжущие смолы;
  • ускорители высыхания;
  • водная дисперсия;
  • антисептические и дополнительные добавки.

Доля веществ у производителей может быть различной, от их процентного соотношения зависит плотность состава и то, сколько сохнет акриловая грунтовка. Вариант на водной основе обладает способностью быстро наполнять поры материала, улучшает сцепление плоскостей из древесины, кирпича, бетона, фанеры, но не подходит для обработки металла вследствие возникновения коррозии. Не имеют запаха, а срок сушки – около 4 часов.

2. Алкидные.

Полностью заполняют поры и имеющиеся щели, укрепляют поверхность, улучшают сцепление шпатлевки и краски со стеной или иным основанием. Применяются для металла и дерева, но не подходят для гипсовых или оштукатуренных покрытий по причине неглубокого впитывания, сохнут на протяжении суток.

3. Перхлорвиниловые.

По причине содержания токсичных ингредиентов не рекомендуются к нанесению внутри зданий. Возможно использование для любых материалов, особенно металлических. Предотвращают возникновение и развитие коррозионных процессов и защищают от разрушения. Ликвидируют очаги застаревшей ржавчины глубиной до 100 мкм. Сохнет в зависимости от толщины коррозионного слоя. Время сушки, составляющее при 20°C около часа, можно уменьшить добавлением различных ускоряющих ингредиентов.

4. Поливинилацетатные.

Смеси с добавлением латекса примечательны тем, что пигмент увеличивает яркость краски. Пригодны для нанесения на стены из любых материалов, а на гипсокартоне способны полностью загладить ворс. На поверхности образует однородное покрытие, позволяющее снизить расход отделки. Время высыхания зависит от толщины и температуры окружающего воздуха: при 20°C и укладывании в один пласт срок – около получаса.

5. Фенольные.

Такие растворы идеальны для использования на открытом воздухе при обработке элементов веранд, беседок, террас. Защищают основание от колебаний температуры и воздействия влаги. На то, за сколько высохнет грунтовка, влияет количество специальных добавок. В теплое время года готовность к отделке наступает спустя 8 часов.

Рекомендации по применению

Сколько времени сохнет грунтовка, обычно указывается на упаковке. Следует учитывать тот факт, что указанный срок является усредненным и к нему необходимо добавить как минимум 1 час. Если не указан период высыхания, то можно принять среднее значение 4 часа для одного слоя при влажности 65 % и температуре 25°С. При нанесении в несколько пластов время нужно увеличить.

Готовность покрытия проверяется полиэтиленовой пленкой, которая закрепляется на плоскости при помощи скотча. Отсутствие конденсата с внутренней стороны материала свидетельствует о том, что разрешено приступать к отделочным работам. Если уверенности нет, то следует выждать сутки, так как некоторые виды впитываются до 14 дней.

Перед обработкой нужно удалить масляные пятна и загрязнения. Для использования на открытом воздухе и в помещениях с высокой влажностью применяются специальные смеси. Грунтовка глубокого проникновения сохнет от 2 до 6 часов, степень паропроницаемости поверхности при этом остается неизменной.

длительность высыхания грунта глубокого проникновения или акриловой, советы и рекомендации

Технологии ремонта и нового строительства считают обязательным этапом грунтование поверхностей на большинстве этапов работ. Покрытие стен грунтом производят перед штукатуркой, наклейкой плитки, шпаклевкой и перед покраской.

Сколько сохнет грунтовка на стене

сколько сохнет грунтовка на стенеГрунтом называется смесь смол, олифы, растворителей, которая применяется для подготовки стен к проведению следующего этапа.

Зачем наносить грунтовку на стены

Специалисты считают обязательным процесс пропитки по следующим причинам:

  1. Процесс усиливает прочное сцепление краски, обоев или другого покровного материала с основанием за счет проникновения пропиточного состава в поры материала и склеивания частиц.
  2. Нанесения грунта выравнивает неровности и шероховатости.
  3. Отделочный материал к ровной поверхности прикрепляется лучше, межремонтный период длится дольше, что сократит затраты.
  4. Современные грунты препятствуют развитию грибковых образований.

Сколько слоев наносят

Гипсокартон достаточно пропитать один раз, поскольку листы гипсокартона ровные, их впитывающая способность дает пропитке проникнуть на достаточную глубину.

Специалисты рекомендуют на грунте не экономить и наносить не менее двух слоев перед каждым следующим этапом, штукатурке, шпаклевке, покраске, наклейке обоев или плитки.

сколько сохнет грунтовка на стене

Бетонную стену под оштукатуривание или шпаклевку стоит обработать кварцевой грунтовкой, чтобы обеспечить сцепление с бетоном покровного материала на следующем этапе.

Сколько сохнет

сколько сохнет грунтовка на стенеПроизводители указывают на упаковке время при стандартных условиях, но следует учитывать факторы, от которых зависит время полимеризации состава:

  1. Толщина нанесенной слоя.
  2. Растворитель смеси, в течение 3-4 часов сохнут акриловые, масляные и контактные требуют до суток.
  3. Время зависит от состояния материала, сухая и пористая схватывается быстрее, недавно оштукатуренная потребует больше времени.
  4. Быстрее полимеризуется при положительной температуре и сухом воздухе.

В зависимости от вида грунта время на высыхание различается:

  • Акриловым требуется не менее 300 минут после нанесения.
  • Алкидным нужно 20 часов.
  • Глифталевые требует не менее суток.

На бетонной стене

Минимальное для полимеризации время зависит от применяемого грунта:

  1. Акриловые на бетонной стене схватываются за 5-6 часов при комнатной температуре и средней влажности.
  2. Кварцевые, называемые еще контактными, сохнут 60 минут при пропитке один раз.
  3. Перхлорвиниловые применяются для бетонных оснований, полимеризация происходит за 25-30 минут.

Если стена не липкая и не пачкает руку, значит стена высохла и нужно начинать следующий этап.

На кирпичной со штукатуркой

сколько сохнет грунтовка на стенеПрактика применения пропиточной смеси по штукатурке, сделанной из песка с цементом, показывает, что времени требуется по такой поверхности от 2 до 3 часов, с добавлением извести нужно в два раза больше.

Акриловые смеси на кирпиче высыхают за 5-6 часов, а перхлорвиниловым нужно 30 минут. Бетоноконтактные используются для пропитки по штукатурке, полимеризация длится от четверти суток.

На бетонной стене перед штукатуркой

Пропитка глубокого проникновения на бетоне под этап оштукатуривания при температуре от 18 до 25 градусов и нормальной влажности подсохнет за 120 минут, такое же время потребуется грунтовке на воде.

сколько сохнет грунтовка на стене

Бетоноконтактные применяются для оштукатуренных или бетонных оснований, сохнет не меньше четверти суток.

На деревянных стенах

Для деревянных оснований подойдет состав на спиртовой основе или олифа, также используют алкидную и масляную пропитки. К времени на упаковке, указанной производителем, для уверенности в завершении процесса, нужно прибавлять еще 60 минут. Акриловые на дереве высыхают за четверть суток. Покрытие алкидными смесями на деревянной основе сохнет за полсуток при 23-25 градусах.

Шеллаковые на спиртосодержащих растворителях для обработки дерева сохнут на деревянной поверхности половину суток. Масляные используются на деревянных конструкциях, рекомендованное время до начала следующего этапа 1 сутки.

Как долго высыхает на стене грунтовка глубокого проникновения

сколько сохнет грунтовка на стенеГрунтовочные составы глубокого проникновения имеет в составе акриловые соединения и используется для слабых поверхностей, чтобы укрепить и снизить возможность впитывать влагу.

Для высыхания акриловой смеси требуется подождать ночь.

Бетоноконтактные сохнут от 1 до 6 часов, зависит от количества слоев.

Когда можно красить клеить и шпаклевать

На шпатлевку грунтовочный слой ложится хорошо и быстро высыхает, но, все же, специалисты рекомендуют дождаться полного высыхания, иначе обои сморщатся или появятся пузыри. На цементно-песчаной штукатурке пропиточная смесь схватывается за 2-3 часа, а на цементно-известковой нужно ждать 4-6 часов, но шпаклевку можно начинать до полного высыхания. Также стоит помнить:

  1. Окрашивать прогрунтованные шпаклеванные стены следует при полной полимеризации.
  2. Окраска со старой краской производится после полимеризации смеси, в этом случае отслоения старой краски не произойдет.
  3. Покраска по штукатурке без шпаклевки нуждается в покрытии грунтовочным составом не менее чем двумя слоями, и каждый накладывается на полностью высохший предыдущий, для полной готовности к покраске потребуется не менее четверти суток.

Популярные виды грунтов универсального типа

сколько сохнет грунтовка на стенеСпециалисты выбирают определенную состав пропитки под конкретный вид работ, новичку, чтобы не ошибиться или в случае работы с разными материалами, лучше использовать универсальный грунт, который подойдет для ремонта помещения.

Универсальные пропитки используются для различных материалов, в зависимости от состава различаются такие виды:

  1. Универсальная акриловая.
  2. Грунтовка глубокая универсальная.
  3. Латексная универсальная.

В список десяти лучших грунтовочных смесей глубокого проникновения входят:

  1. «Старатели».
  2. «Церезит».
  3. «Оптимист».
  4. «Боларс».
  5. «Текс».
  6. «Кнауф».
  7. «Лакра».
  8. «ЛАЭС».
  9. «ГЛИМС».
  10. «AXTON».

Грунтовка считается при строительстве и ремонте вспомогательным материалом, однако от соблюдения технологии нанесения ее на поверхности помещения, зависит качество и долговечность произведенного ремонта, продолжительность межремонтного интервала.

Поскольку для ремонта нужно относительно немного состав, специалисты настоятельно рекомендуют при ремонтных работах этап пропитки производить в соответствии с технологией не менее 2 раз.

Полезное видео

Можно ли использовать латексную краску поверх грунтовки на масляной основе?

Can of Yellow Latex Paint © Мариуш Блах / Fotolia

Вы наверняка слышали на протяжении всей своей жизни, что масляные краски нельзя смешивать с другими типами красок. В то же время вам, возможно, сказали, что вы можете использовать латексную краску поверх грунтовки на масляной основе. Оба эти убеждения верны, что на первый взгляд может показаться запутанным. Факты, разобранные однажды, гораздо менее запутаны, чем кажутся на первый взгляд.

Почему масляные краски нельзя смешивать

Краски на масляной основе использовались веками, и, несмотря на многочисленные инновации, некоторые факты остались заметными в мире искусства.Во-первых, масляные краски сохнут долго. Современные масляные краски сохнут намного быстрее, однако они все же сохнут с другой скоростью, чем латексные или акриловые. Кроме того, если вы будете использовать масляную краску поверх латекса, новая краска будет расширяться и сжиматься с другой скоростью, чем нижележащий слой, вызывая его растрескивание. Латекс не будет правильно держаться при нанесении непосредственно поверх слоя на масляной основе без предварительной подготовки и может легко потрескаться или отслоиться.

Использование латекса на грунтовке на масляной основе

Есть много причин использовать латексную краску поверх масляной грунтовки, и в результате получается прочная и долговечная поверхность.Как правило, латексные грунтовки используются для гипсокартона и мягких пород дерева, хотя есть несколько заметных исключений. Масляные грунтовки и краски сохнут дольше и требуют дополнительной вентиляции, а это означает, что смесь латекса и масла может сократить время и уменьшить дискомфорт без ущерба для прочности.

Причины выбрать грунтовку на масляной основе

Хотя некоторые марки грунтовок могут универсально работать как с масляными, так и с латексными красками, бывают случаи, когда грунтовка на масляной основе более эффективна, чем латексная грунтовка.Эти экземпляры включают:

  • лакированная или необработанная древесина
  • Древесина, склонная к выделению танинов, например красное дерево и кедр
  • Закрашивание меловой или сильно поврежденной краски
  • Древесина, сильно выветрившаяся
  • влажная среда, например ванные комнаты
  • можно тонировать в магазине красок, если вы будете использовать очень светлые или темные цвета

Определение наличия масляной краски для стен


Есть несколько важных шагов, которые необходимо выполнить при попытке добавить латексную краску на уже окрашенную стену, наиболее важный из которых - определить, будете ли вы красить масляную краску.Чтобы подготовиться к новой краске, выполните следующие действия:

  1. Почувствуйте стену. Масло гладкое и глянцевое, а латекс имеет тенденцию быть матовым и иметь более резиновую поверхность.
  2. Окуните ватный тампон в ацетон и проверьте окрашенную поверхность. Латекс немного растворится, в то время как масло останется неизменным.
  3. Если вы определили, что существующая краска на масляной основе, вам нужно будет отшлифовать поверхность наждачной бумагой с зернистостью 100 до исчезновения блеска, затем вымыть поверхность и дать ей высохнуть.Теперь вы можете добавить связующий грунт.

Нанесение латекса на масляную грунтовку

Для высыхания грунтовок на масляной основе требуется не менее восьми часов. Возможно, вам придется слегка отшлифовать грунтовку по гладким деревянным поверхностям наждачной бумагой с зернистостью 180, чтобы обеспечить более легкое приклеивание поверхности. Обязательно смойте пыль, образовавшуюся от шлифования, и дайте поверхности высохнуть, прежде чем добавлять краску. Как правило, поверх грунтовки требуется два равномерно нанесенных слоя латексной краски. Дайте каждому слою высохнуть от двух до четырех часов.

Между грунтовкой и двумя слоями латекса потребуется около 16 часов для высыхания помещения. Сюда не входит время высыхания после очистки и время, необходимое для самого процесса покраски. Однако вы можете распределить проект на несколько дней, если работа будет завершена в течение двух недель после нанесения грунтовки.

Дополнительные ресурсы

GeeksOnHome предоставляет подробное руководство по покраске с использованием грунтовок на масляной основе алкидного типа.

Сегодняшний домовладелец предлагает руководство, в котором подробно обсуждаются различия между грунтовками на основе масла, латекса и шеллака.

Связанные

.

Расчет концентраций праймера и зонда | Thermo Fisher Scientific

В следующих случаях вам потребуется рассчитать концентрацию праймеров или зондов в растворе:

  • Вы впервые синтезировали свои собственные праймеры или зонды, но не знаете, как определить их концентрацию.
  • Вы не восстановили и не извлекли весь лиофилизированный (лиофилизированный) порошок из пробирки, содержащей праймер или зонд, поэтому вы не уверены в концентрации вашего запаса.
  • У вас есть исходный раствор праймера с ранее известной концентрацией, который не помечен или промаркирован неправильно, поэтому вы не знаете его концентрацию.

В качестве альтернативы вам может быть сложно рассчитать количество жидкости, необходимое для восстановления известной массы лиофилизированного праймера или зонда, чтобы достичь желаемой концентрации для ваших рабочих масс.

Если какая-либо из этих проблем кажется вам актуальной, следующие простые примеры содержат советы, как их решить.-12) молей на литр.

Начнем с примера исследователя, который впервые синтезировал праймеры. Они намеревались использовать праймеры для обнаружения экспрессии фактора роста эндотелия сосудов (VEGF) в человеческих фибробластах. Исследователь получил неизвестное количество синтезированных праймеров в буфере, и ему нужно было рассчитать концентрацию праймеров в этом растворе, чтобы они могли его правильно использовать. Простая формула может решить эту задачу, но сначала нам нужно получить дополнительную информацию.

В этом примере прямая цепь праймера (ориентация от 5 ’к 3’) читается как CAAGACAAGAAAATCCCTGTGG. Первым шагом в этом процессе является спектрофотометрический анализ праймера для определения его оптической плотности при 260 нм (известной как A260). Чтобы не тратить зря драгоценный праймер, исследователь разбавил его 1: 100 в буфере 1X TE до конечного объема 1 мл (10 мкл раствора праймера и 990 мкл 1X TE - это коэффициент разбавления 100 ) . Затем исследователь определил A260 разбавленного образца, который составил 0.135 , и принял во внимание длину пути кюветы, используемой в спектрофотометре, которая составила 0,4 см . Подводя итог, исследователь располагает следующей информацией: A260 проанализированного образца праймера ( 0,135 ), его коэффициент разбавления ( 100 ) и длина пути использованной кюветы ( 0,4 см ).

Однако исследователю нужно было собрать еще один кусок головоломки, прежде чем он смог применить формулу. Они должны были рассчитать сумму вкладов коэффициентов экстинкции азотистых оснований в цепи праймера.Это может показаться сложным, но это не так: по сути, каждому основанию нуклеиновых кислот (аденин, цитозин, гуанин и тимин) в цепи присваивается значение, и нам просто нужно их сложить.

Вот значения, которые должны применяться к каждому из четырех азотистых оснований. Эти значения известны как коэффициенты экстинкции хромофора, и если вы используете этот метод, вам нужно будет применить их к последовательности праймера.

Нуклеотид

Коэффициент экстинкции хромофора

А

15 200

К

7 050

г

12 010

т

8,400

Итак, для цепи праймера в этом примере (CAAGACAAGAAAATCCCTGTGG) имеется:

9 Как: (15,200 x 9)

5 Cs: (7,050 x 5)

5G: (12,010 x 5)

3 Ts: (8,400 x 3)

Давайте сложим.-1

После того, как исследователь получил эту информацию, он смог применить следующую формулу для вычисления концентрации праймера в моль / литр [1].

Концентрация в моль / литр (Кл) = (коэффициент разбавления × A260) ÷ (сумма вкладов коэффициента экстинкции × длина пути кюветы)

В нашем примере это будет:

C = (100 x 0,135) ÷ (257,300 x 0,4)

C = 13,5 ÷ 102,920

C = 0,000131 M

Это число моль / литр немного громоздко, поэтому мы можем преобразовать его в единицы мкМ, умножив значение на 10 ^ 6, чтобы получить конечную концентрацию.

C = 131 мкМ

Что, если мы хотим рассчитать концентрацию олигонуклеотидных зондов с флуоресцентными красителями? Процедура почти идентична, с одним ключевым отличием: нам нужно учесть коэффициенты экстинкции хромофора красителей в зонде, прежде чем применять ту же формулу.

Вот некоторые коэффициенты экстинкции хромофоров для обычно используемых красителей.

Краситель

Коэффициент экстинкции хромофора

FAM

20 958

ТАМРА

31 980

ТЕТ

16,255

JOE

12 000

ВИК

30,100

Для простоты воспользуемся олигонуклеотидной цепью в приведенном выше примере (CAAGACAAGAAAATCCCTGTGG), но на этот раз предположим, что исследователь синтезировал ее в качестве зонда и краситель FAM прикреплен к 5 'концу, а краситель TAMRA присоединен к 3' конец.

В этом сценарии формула такая же, как та, которую мы использовали в первом примере праймера, и мы делаем расчет таким же образом. Теперь, однако, мы должны сложить коэффициенты экстинкции двух красителей при вычислении суммы.

Итак, для зонда в этом примере (краситель TET - CAAGACAAGAAAATCCCTGTGG - краситель JOE) имеется:

9 Как: (15,200 x 9)

5 Cs: (7,050 x 5)

5G: (12,010 x 5)

3 Ts: (8,400 x 3)

1 краситель FAM: (20,958 x 1)

1 краситель TAMRA: (31,980 x 1)

Давайте сложим.

(15 200 x 9) + (7 050 x 5) + (12 010 x 5) + (8 400 x 3) + (20 958 x 1) + (31 980 x 1)

136,800 + 35,250 + 60,050 + 25,200 + 20,958 + 31,980 = 310,238 М-1 см-1

Затем исследователь может использовать эту сумму вкладов коэффициента экстинкции в формулу точно так, как описано выше, и все остальные аспекты расчета остаются такими же.

C = (100 x 0,135) ÷ (310 238 x 0,4)

C = 13,5 ÷ 124 095

C = 0,000109 M (109 мкМ)

Если вы покупаете праймер или зонд, он обычно поступает в пробирку в виде лиофилизированного порошка с массой в пикомолях (пмоль - см. Список единиц выше) и требует восстановления в буфере перед использованием.Если вам сложно рассчитать необходимое количество жидкости, с помощью которой можно восстановить известную массу лиофилизированного праймера или зонда до желаемой концентрации, следующий пример прояснит это.

Во-первых, определите концентрацию, необходимую для вашего рабочего запаса. Для праймеров это обычно составляет 10–100 мкМ, а для зондов - 2–10 мкМ. Давайте рассмотрим пример, чтобы рассчитать объем буфера, необходимый для восстановления праймеров в желаемой концентрации.

Исследователь покупает лиофилизированный праймер для EFNB2, гена, участвующего в росте кровеносных сосудов.6 = 0,120 мкмоль

После того, как исследователь узнал массу праймера в мкмоль, он смог использовать следующую простую формулу [2] для расчета объема жидкости в литрах, необходимого для ее восстановления до конечной концентрации 60 мкМ.

Объем в литрах = масса растворенного вещества ÷ желаемая концентрация

В данном случае: Объем в литрах = 0,120 мкмоль ÷ 60 мкМ

Объем в литрах = 0,002 л

Мы можем преобразовать этот объем в более удобную единицу, мл, умножив на 1000 (поскольку в 1 л содержится 1000 мл).

0,002 x 1000 = 2 мл

Если исследователь восстановит праймер EFNB2 в 2 мл жидкости (например, 1X TE-буфер), он достигнет конечной концентрации 60 мкМ. Затем раствор можно разделить на аликвоты и хранить до тех пор, пока он не понадобится.

Как мы проиллюстрировали, расчеты для определения концентраций праймеров и разведений несложны, и если вы проработаете примеры, представленные здесь, вы сможете с уверенностью и точностью приготовить и использовать рабочие растворы олигонуклеотидов.

Список литературы

1. TaqMan Fast Virus 1-Step Master Mix, руководство (см. Стр. 26}
2. Восстановление и разведение праймеров и пробников TaqMan, примечание по применению

.

KILZ 2® Latex Multipurpose Primer, Sealer Stainblocker

.

KILZ 2® УНИВЕРСАЛЬНЫЙ Интерьер | Внешняя грунтовка оценена 4,7 из 5 пользователем 649.

Оценка 4 из 5 по Картина Пальметто из KILZ-Killed It! Беспокоился о том, что в комнате моей дочери накрывают поп-терпкий цвет, но это отлично сработало!

Дата публикации: 2020-08-10

Оценка 5 из 5 по Твиты от Отличный праймер! Я купил это неделю назад, и это действительно потрясающая грунтовка!

Дата публикации: 2020-08-10

Оценка 1 из 5 по ClevelandTX из Мармелад.Не могу отшлифовать это Я купил его, потому что доверяю бренду kilz. Я нанёс очень тонкий слой белой сосны и предварительно загрунтовал материал для суставов пальцев. Прошло 36 часов, и есть большие липкие участки. Сначала подумал, может, купил грунтовку, которую нельзя шлифовать. Пытаюсь красить новые полки кладовой. Я купил не тот товар? Это разрушило мой проект.

Дата выпуска: 2020-08-06

Оценка 5 из 5 по Sheetsy из Праймер Perfect Мы купили это неделю назад, чтобы закрасить дымку на потолке.2 слоя спустя, выглядит отлично! Настоятельно рекомендуется и очень скоро буду покупать снова. Большое спасибо за качественный продукт!

Дата публикации: 2020-07-29

Подготовка поверхности *

Следующие шаги рекомендуются для повышения производительности продукта.

  • Все поверхности должны быть чистыми, очищенными от пыли, мела, масла, жира, воска, полироли, плесени и плесени, отслаивающейся краски, ржавчины и всех других посторонних веществ.

  • Если необходима стирка, используйте немыльное моющее средство или заменитель TSP, хорошо промойте и дайте высохнуть.

  • Неокрашенное внешнее дерево, подверженное воздействию солнца и / или влаги более 2-4 недель, перед грунтованием необходимо очистить и отшлифовать.

  • Глянцевые поверхности: Для максимальной адгезии тщательно отшлифуйте поверхность перед грунтованием. *

  • Отслаивающаяся или проверенная краска: Соскребите отслаивающуюся краску и отшлифуйте до гладкой поверхности.*

  • Поверхности, покрытые плесенью или плесенью: промойте участок средством для удаления плесени, промойте водой и дайте высохнуть перед нанесением грунтовки.
  • Кладка, кирпич, штукатурка и штукатурка: УНИВЕРСАЛЬНАЯ грунтовка KILZ 2 может использоваться на чистых, сухих, состаренных поверхностях кладки. Перед нанесением универсальной грунтовки KILZ 2 ALL-PURPOSE Primer необходимо дать новой кладке высохнуть не менее чем за 30 дней.
  • Восстановление от пожара: Перед нанесением грунтовки необходимо тщательно очистить поврежденные поверхности. Рекомендации по грунтовке: грунтовки на водной основе, такие как KILZ® RESTORATION, или грунтовки на масляной основе, такие как KILZ® ORIGINAL (для внутренних работ) или KILZ® ORIGINAL EXTERIOR.

Приложение

  • Рекомендуются средства защиты глаз. Для распыления можно добавить небольшое количество воды (не более 1/2 пинты на галлон).
  • Не разбавлять для пятновыводящих средств. Применять только в том случае, если температура поверхности, воздуха и продукта находится в пределах 10–32 ° C (50–90 ° F).
  • Тщательно перемешивайте перед использованием и время от времени во время использования.
  • Кисть - высококачественный нейлон / полиэстер.
  • Валик - Высококачественный ворс 3/8-1 / 2 дюйма на гладких поверхностях или ворс 1 / 2-3 / 4 дюйма на полушероховатых или пористых поверхностях.
  • Безвоздушное распыление - наконечник 0,017-0,021 / фильтр 60 меш.
  • Загрунтуйте всю поверхность, чтобы обеспечить равномерный внешний вид финишного покрытия.
  • Блокирование пятен: УНИВЕРСАЛЬНЫЙ праймер KILZ 2 разработан для блокирования светлых и средних пятен. Для сильных пятен используйте грунтовки на масляной основе, такие как KILZ® ORIGINAL и KILZ® ORIGINAL EXTERIOR, или грунтовки на водной основе, такие как KILZ® RESTORATION и KILZ® PREMIUM.
  • Колеровка: KILZ 2 ALL-PURPOSE Primer можно тонировать с использованием до 2 унций универсального красителя на галлон.Рекомендуется подкрашивать до более светлого оттенка, чем финишное покрытие.
  • Расход: 300–400 кв. Футов (27,87–37 м²) на галлон в зависимости от метода нанесения и пористости поверхности.

Время высыхания при 77 ° F (25 ° C) / 50% относительной влажности

  • Высыхает на ощупь за 30 минут.

  • Можно перекрыть или перекрыть за один час латексной или масляной краской.

  • Нанесение при более низких температурах, в условиях высокой влажности или в плохо вентилируемых помещениях повлияет на время высыхания.

Очистка и утилизация

  • Очистите оборудование и брызги краски теплой мыльной водой.

  • Не выбрасывайте этот продукт в канализацию. Пожалуйста, рассмотрите возможность пожертвовать любой неиспользованный продукт. Для получения информации о переработке или утилизации обратитесь в местную службу вывоза бытового мусора
    .

  • В случае разлива собрать материал и удалить инертным абсорбентом. Утилизируйте загрязненный абсорбент, контейнер и неиспользованный продукт в соответствии со всеми действующими федеральными, государственными и местными правилами.Для получения информации о переработке или утилизации обратитесь в местную службу сбора бытовых отходов
    .

ПОЖИЗНЕННАЯ ОГРАНИЧЕННАЯ ГАРАНТИЯ

Masterchem Industries LLC гарантирует вам, первоначальному покупателю-потребителю, работоспособность этого продукта в соответствии с описанием на этой этикетке, пока вы проживаете в своем доме. Если в результате проверки представителем этого продукта будет обнаружен дефект, Masterchem Industries LLC по своему усмотрению и при предъявлении доказательства покупки (оригинала квитанции) либо предоставит эквивалентное количество нового продукта, либо возместит первоначальную покупку. цена этого продукта вам.Данная гарантия не подлежит передаче. Данная гарантия не включает (1) труд и затраты на рабочую силу для установки или удаления любого продукта и (2) любые побочные или косвенные убытки, вызванные нарушением явной или подразумеваемой гарантии, халатностью, строгой ответственностью или любой другой юридической теорией. . В некоторых штатах не допускается исключение или ограничение случайных или косвенных убытков, поэтому вышеуказанное ограничение или исключение может не относиться к вам. В той степени, в которой это разрешено применимым законодательством, любые подразумеваемые гарантии, включая подразумеваемые гарантии товарной пригодности и пригодности для определенной цели, ограничиваются сроком действия данной прямой гарантии.В некоторых штатах не допускается ограничение срока действия подразумеваемой гарантии, поэтому вышеуказанное ограничение может не относиться к вам. Эта гарантия дает вам определенные юридические права, и вы также можете иметь другие права, которые варьируются от штата к штату. Примечание для жителей штата Нью-Джерси: Положения данной гарантии, включая ее ограничения, предназначены для применения в максимальной степени, разрешенной законами штата Нью-Джерси. Для гарантийного обслуживания звоните: 1-866-774-6371 или по электронной почте: techservice @ masterchem.com. Masterchem Industries LLC оставляет за собой право проверять любое применение продукта перед обработкой вашей претензии по данной гарантии.

Внимание!

Этот продукт содержит химические вещества, которые, как известно в штате Калифорния, вызывают рак, врожденные дефекты или другие нарушения репродуктивной системы.

ИСПОЛЬЗУЙТЕ ТОЛЬКО С ДОПОЛНИТЕЛЬНОЙ ВЕНТИЛЯЦИЕЙ

Предупреждение! Раздражает!

ОСТОРОЖНО РАЗДРАЖАЮЩИЙ Избегайте контакта с глазами.Может вызвать раздражение глаз, носа и горла. Избегайте вдыхания пыли, паров или аэрозольного тумана. Откройте окна и двери или используйте другие средства для обеспечения доступа свежего воздуха во время нанесения и высыхания. Если вы испытываете слезотечение, головную боль или головокружение или если мониторинг воздуха показывает, что уровни пара / тумана превышают применимые пределы, наденьте соответствующий, правильно подогнанный респиратор (NIOSH / MSHA TC -23C или аналогичный) во время и после нанесения. Следуйте инструкциям производителя респиратора по использованию респиратора.Закройте контейнер после каждого использования. Тщательно вымыть после работы, а также перед курением или едой.

Внимание!

Если поскрести, отшлифовать или удалить старую краску, может образоваться свинцовая пыль. Свинец Ядовит. ВОЗДЕЙСТВИЕ СВИНЦОВОЙ ПЫЛИ МОЖЕТ ПРИВЕСТИ К СЕРЬЕЗНЫМ ЗАБОЛЕВАНИЯМ, ТАКИМ КАК ПОВРЕЖДЕНИЕ МОЗГА, ОСОБЕННО У ДЕТЕЙ. БЕРЕМЕННЫМ ЖЕНЩИНАМ ТАКЖЕ СЛЕДУЕТ ИЗБЕГАТЬ ВОЗДЕЙСТВИЯ. Наденьте респиратор, одобренный NIOSH, чтобы контролировать воздействие свинца. Тщательно очистите пылесосом HEPA и влажной шваброй. Перед тем, как начать, узнайте, как защитить себя и свою семью, позвонив на национальную горячую линию информации для руководителей по телефону 1-800-424-LEAD или войдите на сайт www.epa.gov/lead.

Первая помощь

При проглатывании не вызывать рвоту. Немедленно обратитесь за медицинской помощью. Если вы испытываете затрудненное дыхание, выйдите из помещения, чтобы подышать свежим воздухом. Если трудности не исчезнут, немедленно обратитесь за медицинской помощью. В случае попадания в глаза немедленно промойте глаза большим количеством воды в течение не менее 15 минут и обратитесь за медицинской помощью.

НЕ ЗАМЕРЗАТЬ. Если заморожен, дайте ему разморозиться при комнатной температуре.

ХРАНИТЬ В недоступном для детей месте

.

PERM-A-BARRIER® WB Primer (версия для США) | Ресурс

Описание продукта

PERM-A-BARRIER® WB Primer - это грунтовка на водной основе, которая придает агрессивную отделку с высокой липкостью обработанной поверхности. Он специально разработан для облегчения прочной адгезии шпунтов PERM-A-BARRIER®, мембран PERM-A-BARRIER® Detail Membrane и стеновых мембран PERM-A-BARRIER® к различным субстратам, включая гипсовую обшивку с покрытием из стекломата. См. Техническое письмо 2, Подготовка основания для нанесения продуктов PERM-A-BARRIER® на гипсовую оболочку с покрытием из стекломата, где указаны требования к грунтовке конкретных продуктов с покрытием из стекломата.

Преимущества продукта

  • Отличная адгезия - сцепляется с основанием и связывает пыль
  • Агрессивная липкость - обеспечивает прочное сцепление с трудными поверхностями, такими как DensGlass Gold и другие облицованные стеклом стеновые панели
  • Быстросохнущий - повышенная гибкость графика нанесения
  • Быстрое и простое нанесение - кистью или валиком
  • Соответствует VOC - на водной основе, не содержит опасных или легковоспламеняющихся растворителей
  • Со слабым запахом - без вредных паров

Использовать

PERM-A-BARRIER® WB Primer можно использовать при температуре 25 ° F (-4 ° C) или выше.Он замерзнет при температуре 21 ° F (-7 ° C), и его больше нельзя будет использовать после замерзания.

Наличие

PERM-A-BARRIER® WB Primer выпускается в кувшинах на 1 галлон и пластиковых ведрах на 5 галлонов.

Установка

Информация о безопасности, хранении и обращении

PERM-A-BARRIER® WB Primer негорючий. SDS (паспорт безопасности) доступен на gcpat.com, и пользователи должны ознакомиться с этой информацией. Перед использованием внимательно прочтите подробные меры предосторожности на этикетках продукта и паспорт безопасности.

Хранить при температуре выше 0 ° C (32 ° F).

Содержание ЛОС (летучих органических соединений) составляет 10 г / л, что соответствует стандарту выбросов летучих органических соединений Агентства по охране окружающей среды США для архитектурных покрытий.

Нормы архитектурного и промышленного обслуживания ограничивают содержание ЛОС в продуктах, классифицируемых как архитектурные покрытия. Обратитесь к Техническим письмам на gcpat.com для получения самого последнего списка допустимых ограничений.

Приложение

Наносите грунтовку в сухую погоду при температуре окружающей среды и основания выше 25 ° F (-4 ° C).Поверхность должна быть сухой и чистой.

Подготовка поверхности

Все поверхности должны быть очищены от инея, грязи, жира, масла или других загрязнений. Если не удалить чрезмерную пыль, это может привести к нарушению адгезии мембраны.

В более прохладных или влажных условиях грунтовку можно выполнить заранее. Если загрунтованная поверхность подвергается воздействию более 7 дней или если на поверхности скапливается значительное количество пыли или грязи, повторно загрунтуйте тонким слоем PERM-A-BARRIER® WB Primer.

Роликовая техника

Синтетический, 1/2 дюйма(13 мм) валики для ворса оказались очень успешными для нанесения грунтовки PERM-A-BARRIER® WB Primer. Следует нанести и равномерно раскатать покрытие средней толщины (см. Покрытие ниже). Правильно нанесенное покрытие будет иметь равномерное покрытие и оставит липкую поверхность после высыхания.

Покрытие

250–350 футов 2 / галлон (6,0–8,0 м 2 / л)

Время высыхания

Для достижения эффекта грунтовка PERM-A-BARRIER® WB Primer должна полностью высохнуть.Время высыхания материала зависит от многих факторов, включая температуру, влажность, ветер, солнечный свет и степень покрытия. Время высыхания может варьироваться от 15 минут. (тепло и ветрено) до 3 часов (холодно и безветренно), в зависимости от погодных условий. Ниже приведены рекомендации по времени высыхания при различных температурах:

  • 90 ° F (32 ° C) или выше: 45 мин. – 1 час
  • от 50 ° F (10 ° C) до 90 ° F (32 ° C): 1–3 часа
  • Менее 10 ° C (50 ° F): 3 часа +

Товар упакован «готов к использованию».”Не используйте какие-либо вещества для разбавления этого продукта.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *